Part:BBa_K3930002
β-ionone induction system and expression in S. cerevisiae (pFRAMBOISE-notfused)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 7891
Illegal SpeI site found at 7801
Illegal PstI site found at 7794 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 7891
Illegal SpeI site found at 7801
Illegal PstI site found at 7794 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 7891
Illegal BamHI site found at 753
Illegal BamHI site found at 4082
Illegal XhoI site found at 710
Illegal XhoI site found at 8198 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 7891
Illegal SpeI site found at 7801
Illegal PstI site found at 7794 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 7891
Illegal SpeI site found at 7801
Illegal PstI site found at 7794
Illegal NgoMIV site found at 7390 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 2988
Illegal SapI.rc site found at 7239
Illegal SapI.rc site found at 7449
Introduction
The pFRAMBOISE-notfused part (BBa_K3930002) enables the production of β-ionone from lycopene and is composed of:
- the up (BBa_K3930012) and down (BBa_K3930013) integration sites in the X-3 locus (Chr X: 223616..224744) of the S. cerevisiae genome (based on the plasmid pCfB3032 from Easyclone Marker free kit (Jessop-Fabre et al.,2016)).
- the CrtY gene (BBa_K3930018) codes for a lycopene beta-cyclase, which degrades lycopene into β-carotene. The fyn-phCCD1 gene (BBa_K3930017) codes for a membrane targeted carotenoid cleavage dioxygenase, which allows the production of β-ionone. The sequences were codon optimized for expression into S. cerevisiae.
- the doxycycline inducible promoter (BBa_K3930014), driving the expression of CrtY, and the constitutive promoter TEF1 (BBa_K3930015), driving the expression of fyn-phCCD1.
- the expression block for rtTA-advanced activator of the promoter TetO7 (BBa_K3930019).
- the resistance marker neoR (BBa_K3930020) to select yeast integrants.
Construction
IDT and Twist Bioscience performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with an In-Fusion Takara kit into the pCfB3032 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone 3.
pFRAMBOISE-notfused insert was then linearized with the pFRAMBOISE_pCfB3032_Forward and pFRAMBOISE_pCfB3032_Reverse linearization primers. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows electrophoresis gel of colony PCR to verify integrants genotype. The expected size was obtained for clone D2.
Primer used to clone this part in the pCfB3032:
- pFRAMBOISE_pCfB3032_Forward : 5' acaggcaatactctgcag 3'
- pFRAMBOISE_pCfB3032_Reverse : 5' tctctagaaagtataggaacttcac 3'
pFRAMBOISE-notfused insert integration at locus X-3 was successful. The integrant strain was named LycoYeast-pFRAMBOISE-notfused and saved as glycerol stock.
Characterization
Production of β-carotene
After verifying the correct integration of pFRAMBOISE-notfused insert by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (red) to carotenes (orange).
Figure 3 shows the colors of the colonies with or without inducer. The LycoYeast-pFRAMBOISE-notfused strain plated on a YPD with doxycycline shows a yellow coloration, indicating the conversion of lycopene to β-carotene.
The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after lysis was analyzed by RP-HPLC on a C18 column. In the LycoYeast-pFRAMBOISE-notfused strains, Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of pFRAMBOISE-notfused strains, as well as the in-line following β-ionone production results, this new peak most likely corresponds to β-carotene, the expected precursor. Nonetheless, it seems that repression by the TetO7 system doesn't work, as we observed β-carotene production even in absence of doxycycline.
Production of β-ionone
The β-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020). Figure 5 shows the GC-MS spectrum for the LycoYeast-FRAMBOISE-notfused strain. A peak can be observed at the same retention time as the β-ionone standard for the induced LycoYeast-FRAMBOISE-notfused strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The β-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology). The production of β-ionone, the main molecule of the violet odor, was successfully achieved with this construction.
Conclusion and Perspectives
Our LycoYeast-pFRAMBOISE-notfused strain effectively degrades lycopene into β-carotene and further transforms it into β-ionone. The quantification of β-ionone production remains to be determined under optimal conditions. Moreover our TetO7 promoter needs to be revised for efficient control of CrtY production.
β-ionone belongs to the terpenes family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.
References
- Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.
- Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
- López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.
None |